BBa_K1947000 1 Mms13 Mms13 2016-10-12T11:00:00Z 2016-10-14T02:57:17Z This gene comes from the genome of Magnetospirillum magneticum AMB-1. This part is the coding sequence of Mms13. Mms13 is a particle protein, which was found on the membrane of Magnetosome in Magnetospirillum magneticum AMB-1. Our purpose is to display a protein (in our case it is Spycatcher) on the membrane of Magnetosome by fusing the protein with Mms13. false false _2414_ 33528 34115 9 false This part is used to display a recombinant protein on the membrane of Magnetosome. false zhang xucheng BBa_K1947019 1 BBa_K1947019 This part serves as a catch system expressed in AMB-1. 2016-10-13T11:00:00Z 2016-10-14T02:29:50Z Magnetic bacterium Magnetospirillum magneticum AMB-1 that can produce magnet particles, also called Magnetosome, covered by a bilayer phospholipid membrane, in which Mms13 protein is anchored；Streptococcus pyogenes fibro-nectin-binding protein FbaB contains a domain with a spontaneous isopeptide bond between Lys31 and Asp117. This domain can be splitted into two fragments: the small one is named as Spytag, while the big one is Spycatcher. Spyatcher is separated from the second immunoglobulin-like collagen adhesin domain (CnaB2) which is come from the fibronectin binding protein FbaB. Mms13 is a protein that bound to magnetosome directly and tightly on a bilayer phospholipid membrane of the bacterial magnetic particles (BMPs). GS linker is used to construct the fusion protein to prevent the two protein from influencing each other. And there is a highly specific recognition and covalent conjugation between Spytag (a peptide with 13 amino acids) and Spycatcher (a small protein consisting of 138 residues). The Spycatcher-Mms13-linked Magnetosome can specifically and covalently conjugate to the Spytag-tagged protein in the bacterial lysate and they can be simply co-purified by a magnet. true false _2414_ 33797 33797 9 false We add GS linker to prevent two protein???s conformation from influencing each other. false Jie Tang component2500730 1 BBa_K1947005 component2500729 1 BBa_K1947000 annotation2500730 1 BBa_K1947005 range2500730 1 385 738 annotation2500729 1 BBa_K1947000 range2500729 1 1 378 BBa_K1947005 1 BBa_K1947005 Spycatcher 2016-10-12T11:00:00Z 2016-10-14T02:27:06Z The sequence of this part comes form NCBI This part encodes a polypeptide that can combined with another specific polypeptide, which is named Spytag, through a covalent bond. In our case this polypeptide will be fused with mms13 and anchoring on the membrane of Magentsome at last. And Spytag will be fused with the recombinant protein that we want to purify. true false _2414_ 33797 34115 9 false In our case this polypeptide will be fused with mms13 and anchoring on the membrane of Magentsome at last. And Spytag will be fused with the recombinant protein that we want to purify. false zhang xucheng BBa_K1947005_sequence 1 atggccatggttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctacccatattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttcagatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattacctttacagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatatttaataa BBa_K1947000_sequence 1 atgccctttcaccttgccccctatctggcgaaatccgttcccggcgtcggcgttctcggcgccctggtcggcggcgccgccgccttggccaagaacgtccgcctcctgaaggaaaagcgcatcaccaataccgaagcggccatcgataccggcaaggaaaccgtcggcgccggcctggccaccgcgctttccgccgtggccgcgaccgccgtcggcggcggcctggttgtatcgctgggcaccgccttggtggccggcgttgccgccaaatatgcctgggatcgcggcgtcgatctggtcgagaaggaactgaaccgcggcaaagctgccaacggcgcttccgacgaggacatcttgcgggacgaactggcctaataa BBa_K1947019_sequence 1 atgccctttcaccttgccccctatctggcgaaatccgttcccggcgtcggcgttctcggcgccctggtcggcggcgccgccgccttggccaagaacgtccgcctcctgaaggaaaagcgcatcaccaataccgaagcggccatcgataccggcaaggaaaccgtcggcgccggcctggccaccgcgctttccgccgtggccgcgaccgccgtcggcggcggcctggttgtatcgctgggcaccgccttggtggccggcgttgccgccaaatatgcctgggatcgcggcgtcgatctggtcgagaaggaactgaaccgcggcaaagctgccaacggcgcttccgacgaggacatcttgcgggacgaactggcctaataatactagatggccatggttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctacccatattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttcagatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattacctttacagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatatttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z