BBa_K592009 1 amilCP amilCP, blue chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:48Z Acropora millepora Released HQ 2013 This chromoprotein, amilCP, naturally exhibits very strong color when expressed. The color is blue/purple and is visible to naked eye, thereby requiring no instruments to observe. This DNA was provided by Jeffrey Miller at UCLA. It was made BioBrick-compatible after removal of one illegal internal restriction site (EcoRI). false false _763_ 0 7929 9 In stock true Illegal internal restriction site had to be removed (EcoRI). false Lei Sun annotation2131628 1 amilCP range2131628 1 1 666 BBa_K1947021 1 BBa_K1947021 This part serves as a catch system expressed in E. coli. 2016-10-13T11:00:00Z 2016-10-14T01:58:26Z Streptococcus pyogenes fibro-nectin-binding protein FbaB contains a domain with a spontaneous isopeptide bond between Lys31 and Asp117. This domain can be splitted into two fragments: the small one is named as Spytag, while the big one is Spycatcher. Spytag is separated from the second immunoglobulin-like collagen adhesin domain (CnaB2) which is come from the fibronectin binding protein FbaB. There is a highly specific recognition and covalent conjugation between Spytag (a peptide with 13 amino acids) and Spycatcher (a small protein consisting of 138 residues). A protein of interest with a Spytag at its N- or C-terminus is expressed in E. coli and present in bacterial lysate. true false _2414_ 33797 33797 9 false We add one glycine between Spytag and TEV site to prevent two short peptides from influencing each other. false Jie Tang component2500754 1 BBa_K1947020 component2500753 1 BBa_K592009 annotation2500753 1 BBa_K592009 range2500753 1 1 669 annotation2500754 1 BBa_K1947020 range2500754 1 678 716 BBa_K1947020 1 BBa_K1947020 This polypeptide will be fused with the recombinant protein which we want to purify. 2016-10-13T11:00:00Z 2016-10-14T01:54:38Z Streptococcus pyogenes fibro-nectin-binding protein FbaB contains a domain with a spontaneous isopeptide bond between Lys31 and Asp117. This domain can be splitted into two fragments: the small one is named as Spytag, while the big one is Spycatcher. Spytag is separated from the second immunoglobulin-like collagen adhesin domain (CnaB2) which is come from the fibronectin binding protein FbaB. There is a highly specific recognition and covalent conjugation between Spytag (a peptide with 13 amino acids) and Spycatcher (a small protein consisting of 138 residues). A protein of interest with a Spytag at its N- or C-terminus is expressed in E. coli and present in bacterial lysate.This part encodes a polypeptide that can combined with Spycatcher, through a covalent bond. In our case this polypeptide will be fused with the recombinant protein which we want to purify. true false _2414_ 33797 33797 9 false This part will be fused with the recombinant protein which we want to purify. false Jie Tang BBa_K1947020_sequence 1 gctcatattgtcatggttgatgcttacaagccaactaag BBa_K1947021_sequence 1 atgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataatactagaggctcatattgtcatggttgatgcttacaagccaactaag BBa_K592009_sequence 1 atgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z