BBa_K1947023 1 BBa_K1947023 This part serves as a catch system expressed in <i>E. coli. 2016-10-13T11:00:00Z 2016-10-15T10:22:18Z Streptococcus pyogenes fibro-nectin-binding protein FbaB contains a domain with a spontaneous isopeptide bond between Lys31 and Asp117. This domain can be splitted into two fragments: the small one is named as Spytag, while the big one is Spycatcher. Spytag is separated from the second immunoglobulin-like collagen adhesin domain (CnaB2) which is come from the fibronectin binding protein FbaB. There is a highly specific recognition and covalent conjugation between Spytag (a peptide with 13 amino acids) and Spycatcher (a small protein consisting of 138 residues). A protein of interest with a Spytag at its N- or C-terminus is expressed in E. coli and present in bacterial lysate. false false _2414_ 33797 33797 9 false We add one glycine between Spytag and TEV site to prevent two short peptides from influencing each other. false Jie Tang component2501148 1 BBa_J18918 component2501147 1 BBa_K1159201 component2501150 1 BBa_K592009 annotation2501148 1 BBa_J18918 range2501148 1 48 68 annotation2501147 1 BBa_K1159201 range2501147 1 1 39 annotation2501150 1 BBa_K592009 range2501150 1 75 743 BBa_K592009 1 amilCP amilCP, blue chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:48Z Acropora millepora Released HQ 2013 This chromoprotein, amilCP, naturally exhibits very strong color when expressed. The color is blue/purple and is visible to naked eye, thereby requiring no instruments to observe. This DNA was provided by Jeffrey Miller at UCLA. It was made BioBrick-compatible after removal of one illegal internal restriction site (EcoRI). false false _763_ 0 7929 9 In stock true Illegal internal restriction site had to be removed (EcoRI). false Lei Sun annotation2131628 1 amilCP range2131628 1 1 666 BBa_K1159201 1 BBa_K1159201 Splitted and engineered C-terminal FbaB for isopeptide bound formation (SpyTag) in RFC[25] 2013-09-13T11:00:00Z 2015-05-08T01:09:31Z ''Streptococcus pyogenes'' This part codes for a oligopeptide that is recognized and bound by a covalent isopeptide bound to a protein, called SpyCatcher. That catcher protein for this oligopeptdie can be found under BBa_K1159200. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG annotation2343481 1 SpyTag range2343481 1 1 39 annotation2343512 1 Reactive Asp for isopeptide forming reaction range2343512 1 19 21 BBa_J18918 1 TEVsite TEV cleavage site (E. coli) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis TEV cleaves the following AA sequence with high specificity: * Glu-Asn-Leu-Tyr-Phe-Gln&#8595;Gly but: * Glu-Asn-Leu-Tyr-Phe-Gln&#8595;Ser is also reported Note, the part suggested by the Voigt lab, also contains 2 additional 1xGly flanks for increased accessibility. See also: * BBa_I712077 (TEV N-term) * BBa_I712078 (TEV C-term) * BBa_I712016 (myri+TEV site, Slovenia team igem2007) * BBa_J64007 (Dan Widmaier, Voigt lab) References =========== Dougherty et al. (1989): Molecular genetic analysis of a plant virus polyprotein cleavage site: a model. PMID: 2669323 false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_K1947023_sequence 1 gctcatattgtcatggttgatgcttacaagccaactaagtactagaggaaaacctgtattttcagggctactagatgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa BBa_K592009_sequence 1 atgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa BBa_K1159201_sequence 1 gctcatattgtcatggttgatgcttacaagccaactaag BBa_J18918_sequence 1 gaaaacctgtattttcagggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z