BBa_K1949000 1 Pcold cold inducible promoter (Pcold) 2016-10-05T11:00:00Z 2016-10-11T02:10:58Z We artificial synthesized this. This new promoter, a cold inducible promoter (we call this Pcold) consists of the cspA promoter, Cold Box, 5???-UTR, RBS and DB. This promoter is used to effectively produce proteins at low temperatures. Biobrick Tips This part is not able to be used for most common assembly, because restriction enzyme digestion with XbaI and SpeI generates an unexpected stop codon. Therefore, this part do not meet the criteria of basic parts construction. Our team generated a unique digestion site, BamHI at the upstream of the suffix. We recommend to use this BamHI site for cloning. Characterization false false _2416_ 31979 31979 9 false We applied a point mutation to the Pcold in order to be easy to clone it. We changed the 178th base C to A. An article which we referred describes as stated below. ???we found occasionally that C???A base substitution at nucleotide number 532 in the 5???-UTR region (nucleotide number is according to GenBank Accession No. M30139) diminished this growth inhibition effect (data not shown), allowing easy cloning of the genes of in- terest into MCS. We do not know why this mutation diminished growth inhibition effect but the mutation did not affect productivity of proteins (data not shown).??? (Nakashima,N and Tamura,T. 2004. Cell-free protein synthesis using cell extract of Pseudomonas fluorescens and CspA promoter. Biochemical and Biophysical Research Communications 319 (2004) 672) false Yoshio Takata annotation2491781 1 BamHI range2491781 1 308 313 annotation2490145 1 mutation A to C range2490145 1 177 177 BBa_K1949000_sequence 1 attgctgtttacggtcctgatgacaggaccgttttccaaccgattaatcataaatatgaaaaataattgttgcatcacccgccaatgcgtggcttaatgcacatcaacggtttgacgtacagaccattaaagcagtgtagtaaggcaagtcccttcaagagttatcgttgatacccatcgtagtgcacattcctttaacgcttcaaaatctgtaaagcacgccatatcgccgaaaggcacacttaattattaaaggtaatacactatgtccggtaaaatgactggtatcgtaaaatggttcaacgccggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z