BBa_K1949021 1 BBa_K1949021 rbs-yafN 2016-10-05T11:00:00Z 2016-10-16T04:15:09Z From E.coli This part is antitoxin. true false _2416_ 31979 32067 9 false PCR false Kazuki Fujisawa component2512817 1 BBa_K1949020 component2512815 1 BBa_B0034 annotation2512817 1 BBa_K1949020 range2512817 1 19 315 annotation2512815 1 BBa_B0034 range2512815 1 1 12 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1949020 1 BBa_K1949020 yafN 2016-10-05T11:00:00Z 2016-10-16T04:12:49Z From E.coli. YafO is a toxin. false false _2416_ 31979 32067 9 false PCR. false Kazuki Fujisawa annotation2512809 1 mutation A to C range2512809 1 9 9 BBa_K1949021_sequence 1 aaagaggagaaatactagatgcatcgcattctcgctgaaaaatcggtcaatatcactgagttacgtaaaaacccagctaaatactttattgatcaaccggttgcggttctttctaataatcgccccgcaggatatctcttaagtgccagcgcattcgaagcgttaatggacatgcttgctgaacaagaggagaaaaagcccataaaggcgcgcttccgtccaagtgctgcaagattagaggaaattacacgccgcgctgaacaatatcttaatgatatgacggatgatgatttcaatgactttaaggaataataa BBa_B0034_sequence 1 aaagaggagaaa BBa_K1949020_sequence 1 atgcatcgcattctcgctgaaaaatcggtcaatatcactgagttacgtaaaaacccagctaaatactttattgatcaaccggttgcggttctttctaataatcgccccgcaggatatctcttaagtgccagcgcattcgaagcgttaatggacatgcttgctgaacaagaggagaaaaagcccataaaggcgcgcttccgtccaagtgctgcaagattagaggaaattacacgccgcgctgaacaatatcttaatgatatgacggatgatgatttcaatgactttaaggaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z