BBa_K1949030 1 BBa_K1949030 yafO 2016-10-05T11:00:00Z 2016-10-08T07:23:09Z This part is derived from E.coli,BM26, amplified by using PCR. toxin-antitoxin (TA) systems are cassettes consisting of stable protein, toxin which function as mRNA interferase and unstable protein, antitoxin which destroys function of toxin. Many TA systems exist in the E.coli genome. They can inhibit cell growth or induce cell killing. yafO is one of the toxin and is co-expressed with yafN. &#12288; false false _2416_ 32067 31979 9 false sequence confirmed. false Yoshio Takata BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1949031 1 BBa_K1949031 rbs-yafO 2016-10-05T11:00:00Z 2016-10-14T09:15:07Z This part is derived from E.coli,BM26, amplified by using PCR. This part consists of RBS(<partinfo>BBa_B0034</partinfo>) + yafO(<partinfo>BBa_K1949030</partinfo>) Toxin-antitoxin (TA) systems are cassettes consisting of stable protein, toxin which function as mRNA interferase and unstable protein, antitoxin which destroys function of toxin. Many TA systems exist in the E.coli genome. They can inhibit cell growth or induce cell killing. yafO is one of the toxin and is co-expressed with yafN. &#12288; false false _2416_ 31979 31979 9 false sequence confirmed. false Yoshio Takata component2487953 1 BBa_B0034 component2487954 1 BBa_K1949030 annotation2487953 1 BBa_B0034 range2487953 1 1 12 annotation2487954 1 BBa_K1949030 range2487954 1 19 420 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1949031_sequence 1 aaagaggagaaatactagatgcgggtattcaaaacaaaacttattcgcctgcaacttacagcagaggaacttgatgcgttaacggcggattttatttcctataagcgtgacggtgttttgccagatatatttggtcgcgatgcactctacgacgactcctttacctggccattaatcaaatttgagcgagttgctcatattcatctggcaaatgagaataatccatttccgccacagttgcgccaattcagcagaacgaatgacgaagcgcatttggtatattgtcagggggcgtttgatgagcaagcatggttgctcattgccattctgaaacctgaacctcataaactggctcgagataacaaccaaatgcataaaattgggaaaatggcagaagcgtttcgcatgcgtttttaataa BBa_K1949030_sequence 1 atgcgggtattcaaaacaaaacttattcgcctgcaacttacagcagaggaacttgatgcgttaacggcggattttatttcctataagcgtgacggtgttttgccagatatatttggtcgcgatgcactctacgacgactcctttacctggccattaatcaaatttgagcgagttgctcatattcatctggcaaatgagaataatccatttccgccacagttgcgccaattcagcagaacgaatgacgaagcgcatttggtatattgtcagggggcgtttgatgagcaagcatggttgctcattgccattctgaaacctgaacctcataaactggctcgagataacaaccaaatgcataaaattgggaaaatggcagaagcgtttcgcatgcgtttttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z