BBa_K1096001 1 BBa_K1096001 MazE protein (E. coli) 2013-08-29T11:00:00Z 2015-05-08T01:09:08Z Sequence is obtained K-12 E. coli genome MazE-MazF is a toxin-antitoxin module found in bacteria. MazE is the antitoxin protein. false false _1406_ 0 16236 9 Not in stock false - false Ayten Yazgan Karatas annotation2363715 1 protein range2363715 1 1 252 BBa_K1949104 1 BBa_K1949104 Ptet-RBS-mazE 2016-10-12T11:00:00Z 2016-10-13T04:10:09Z a mazE is antitoxin false false _2416_ 32067 32067 9 false a false Kazuki Fujisawa component2497176 1 BBa_R0040 component2497183 1 BBa_K1096001 component2497181 1 BBa_J61117 annotation2497181 1 BBa_J61117 range2497181 1 63 74 annotation2497176 1 BBa_R0040 range2497176 1 1 54 annotation2497183 1 BBa_K1096001 range2497183 1 81 332 BBa_J61117 1 BBa_J61117 Ribosome Binding Site Family Member 2007-04-23T11:00:00Z 2015-08-31T01:59:49Z N/A {{JCA_Arkin_RBSFamily}} false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K1096001_sequence 1 atgatccacagtagcgtaaagcgttggggaaattcaccggcggtgcggatcccggctacgttaatgcaggcgctcaatctgaatattgatgatgaagtgaagattgacctggtggatggcaaattaattattgagccagtgcgtaaagagcccgtatttacgcttgctgaactggtcaacgacatcacgccggaaaacctccacgagaatatcgactggggagagccgaaagataaggaagtctggtaataa BBa_J61117_sequence 1 aaagacatgagt BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K1949104_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagacatgagttactagatgatccacagtagcgtaaagcgttggggaaattcaccggcggtgcggatcccggctacgttaatgcaggcgctcaatctgaatattgatgatgaagtgaagattgacctggtggatggcaaattaattattgagccagtgcgtaaagagcccgtatttacgcttgctgaactggtcaacgacatcacgccggaaaacctccacgagaatatcgactggggagagccgaaagataaggaagtctggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z