BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1950007 1 BBa_K1950007 ybjG.dev 2016-10-12T11:00:00Z 2016-10-16T04:52:07Z next time This part is assembled [http://parts.igem.org/wiki/index.php?title=Part:BBa_R0011 BBa_R0011] and [http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034 BBa_B0034] and [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1950001 BBa_K1950001] false false _2417_ 24944 24944 9 false next time false Kyohei Takekawa component2501740 1 BBa_K1950001 component2501747 1 BBa_B0015 component2501739 1 BBa_B0034 component2501733 1 BBa_R0011 annotation2501733 1 BBa_R0011 range2501733 1 1 54 annotation2501747 1 BBa_B0015 range2501747 1 687 815 annotation2501739 1 BBa_B0034 range2501739 1 64 75 annotation2501740 1 BBa_K1950001 range2501740 1 82 678 BBa_K1950001 1 BBa_K1950001 ybjG undecaprenyl pyrophosphate phosphatase (from E.coli) 2016-09-15T11:00:00Z 2016-10-06T04:31:19Z atgCGTTCGA TTGCCAGACG TACCGCAGTG GGAGCTGCAC TATTGCTTGT CATGCCAGTA GCCGTATGGA TTTCTGGCTG GCGTTGGCAA CCTGGAGAAC AAAGTTGGCT ACTAAAAGCG GCTTTTTGGG TTACTGAAAC TGTCACCCAG CCCTGGGGCG TCATTACACA TTTGATTTTA TTCGGCTGGT TTCTCTGGTG TCTGCGTTTT CGCATTAAGG CTGCCTTTGT ATTATTTGCC ATTCTGGCGG CCGCAATCCT TGTGGGACAA GGCGTTAAAT CCTGGATCAA AGACAAAGTC CAGGAACCAC GACCTTTTGT TATCTGGCTG GAAAAAACAC ATCATATTCC GGTTGATGAG TTCTACACTT TAAAGCGAGC AGAACGCGGA AATCTAGTGA AAGAACAGTT GGCTGAAGAG AAAAATATCC CACAATATTT GCGTTCACAC TGGCAGAAAG AGACGGGGTT TGCCTTTCCT TCCGGTCACA CGATGTTTGC TGCCAGTTGG GCACTGCTGG CCGTTGGTTT GCTGTGGCCG CGTCGGCGAA CGTTAACCAT TGCTATCTTG CTGGTCTGGG CAACGGGAGT CATGGGAAGC CGCCTGCTGC TCGGGATGCA TTGGCCACGC GATCTGGTAG TAGCTACGTT GATTTCGTGG GCGCTGGTGG CGGTGGCAAC GTGGCTTGCG CAACGAATTT GTGGGCCATT AACACCACCT GCGGAAGAAA ATCGCGAAAT AGCGCAACGA GAACAAGAAA GTtaa phosphatidylglycerophosphatase synthesize a 1,2-diacyl-sn-glycerol 3-phosphate from a 1,2-diacyl-sn-glycerol 3-diphosphate false false _2417_ 24944 24944 9 false false Kyohei Takekawa BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2000 1 -35 range2000 1 20 25 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation2001 1 lac O1 range2001 1 26 42 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1950001_sequence 1 atgctggaaaatttgaatctctctctattctctcttattaacgcgacgccagactcggctccgtggatgatctcgttggcgatttttattgctaaagatttgattaccgtggtgccgttgctggccgtggtactttggttgtgggggcttacagcacaacggcaactggtgataaaaatcgctatcgcgctggcggtcagcctgtttgtgtcctggacgatgggacatctttttccgcacgaccgaccctttgtcgaaaatatcggctataacttcctgcatcatgcggcggatgactcattcccaagcgatcacggtacggtgattttcacctttgcactggcatttttatgctggcatcgcctgtggtccggctcacttttaatggtgctggccgtcgtcattgcctggtcgcgcgtttatcttggcgtccactggccgctggatatgctcggtggattgctggcaggtatgattggctgccttagtgcccagattatctggcaagcgatggggcataaactctatcaacgtctgcaatcgtggtatcgcgtctgttttgcattaccgatccgcaaaggctgggtgcgtgactga BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1950007_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgctggaaaatttgaatctctctctattctctcttattaacgcgacgccagactcggctccgtggatgatctcgttggcgatttttattgctaaagatttgattaccgtggtgccgttgctggccgtggtactttggttgtgggggcttacagcacaacggcaactggtgataaaaatcgctatcgcgctggcggtcagcctgtttgtgtcctggacgatgggacatctttttccgcacgaccgaccctttgtcgaaaatatcggctataacttcctgcatcatgcggcggatgactcattcccaagcgatcacggtacggtgattttcacctttgcactggcatttttatgctggcatcgcctgtggtccggctcacttttaatggtgctggccgtcgtcattgcctggtcgcgcgtttatcttggcgtccactggccgctggatatgctcggtggattgctggcaggtatgattggctgccttagtgcccagattatctggcaagcgatggggcataaactctatcaacgtctgcaatcgtggtatcgcgtctgttttgcattaccgatccgcaaaggctgggtgcgtgactgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z