BBa_K1951002 1 BBa_K1951002 desC, acyl transferase coding sequence 2016-10-09T11:00:00Z 2016-10-11T05:46:37Z The following website gave us information about the gene reference and his chromosomal location. http://strepdb.streptomyces.org.uk/cgi-bin/dc3.pl?accession=AL645882&serial=2769&width=900&start=3031362&end=3041362&iorm=map Start : 3038344 End : 3038898 The coding sequence ised comes from the website below : http://www.ncbi.nlm.nih.gov/nuccore/NC_003888.3 desC is the coding sequence of DesC which is an acyl transferase of the Desferrioxamine production pathway. It is the enzyme of the third step that transform N-hydroxycadaverin into N-acetyl N-hydroxucadaverine by an Acetyl-CoA dependent manner. false false _2418_ 31894 31894 9 false We added prefix and suffix sequences containing the restriction sites (EcoR1, XbaI and SpeI, PstI respectively) false claire raynaud annotation2491886 1 desC range2491886 1 1 558 annotation2491887 1 double stop range2491887 1 555 558 BBa_K1951002_sequence 1 atgagccgcttgagcaccaccacccccgtcggggcactgaccctgcgccccgtcgacccgctgacggacgccgtactgctgcacggctggctcacccaccccaagtccgcgttctggatgatgcaggacgcccggctggtggacgtcgagcgggcctacatggagctggccgccgacgagcaccagcaggcccacctcggcctgcacgacggggtcccggccttcctgacggagcgctacgaccccgcccaccgcgaactggtcgggctgtacgagcccgagccgggcgacgtcggcatgcacttcctggtcgcgcccaccgaccggcccgtgcacggcttcacccgcgccgtgatcaccaccgtgatgacggagctgttcgccgacccggcgacccggcgggtcgtcgtcgaaccggacgtcaccaacaccgccgtgcacgccctgaacgcagccgtcggattcgtgcccgagcgcgagatccagaagccggagaagaaggccttgctgagcttctgcacccgcgagcagttcgcgaaggcggtgtccgcataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z