BBa_K1951007 1 BBa_K1951007 CsgA E. Coli coding sequence 2016-10-10T11:00:00Z 2016-10-11T03:37:03Z The coding sequence has been found on the following website : http://www.ncbi.nlm.nih.gov/nuccore/EU554560.1 CsgA is the major and structural subunit of the curli fimbriae. Curli are coiled surface structures that assemble preferentially at growth temperatures below 37 degrees Celsius. Curli are the major proteinaceous component of a complex extracellular matrix produced by many Enterobacteriaceae. Curli were first discovered in the late 1980s on Escherichia coli strains that caused bovine mastitis, and have since been implicated in many physiological and pathogenic processes of E. coli and Salmonella spp. Curli fibers are involved in adhesion to surfaces, cell aggregation, and biofilm formation. Curli also mediate host cell adhesion and invasion, and they are potent inducers of the host inflammatory response. false false _2418_ 31894 31894 9 false We modified Pst1 site CTGCAG into CTGCGG. We added prefix and suffix sequences containing restriction sites EcoRI, XbaI and SpeI, PstI respectively. false claire raynaud BBa_K1951007_sequence 1 atgaaacttttaaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgctgcggttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z