BBa_K1954009 1 BBa_K1954009 Arg box 2016-10-18T11:00:00Z 2016-10-25T08:36:15Z The sequence is adapted from PMID: 8979336 It is the arginine operator capable of binding ArgR, the common repressor of arginine biosynthetic genes. The introduction of the sequence into a high-copy number plasmid is suspected to titrate the repressor and disinhibit L-arginine production. false false _2421_ 32880 32880 9 false false Kamil Żmijewski annotation2530094 1 Arg box range2530094 1 1 75 BBa_K1954009_sequence 1 atgctttagacttgcaaatgaataatcatccattaaattaattttattcataggcgttagccacaggagggatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z