BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 annotation2000 1 -35 range2000 1 20 25 BBa_K1956041 1 BBa_K1956041 gRNA for Chloramphenicol gene 2016-10-13T11:00:00Z 2016-10-14T09:06:32Z De novo gRNA 1 for Chloramphenicol gene false false _2423_ 24882 24882 9 false NaN false Nitish Kumar Singh BBa_K1956006 1 BBa_K1956006 gRNA for Chloramphenicol gene under lambda pL hybrid promoter 2016-10-13T11:00:00Z 2016-10-14T09:16:49Z Cloning Biobrick gRNA for Chloramphenicol gene under lambda pL hybrid promoter false false _2423_ 24882 24882 9 false NaN false Nitish Kumar Singh component2506268 1 BBa_K1956041 component2506263 1 BBa_R0011 annotation2506268 1 BBa_K1956041 range2506268 1 64 165 annotation2506263 1 BBa_R0011 range2506263 1 1 54 BBa_K1956006_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagtgatgaacctgaatcgccaggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt BBa_K1956041_sequence 1 tgatgaacctgaatcgccaggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z