BBa_K116602 1 CII CII coding region from &#955; phage 2008-10-29T12:00:00Z 2015-05-08T01:09:33Z &#955; phage The CII coding region from &#955; phage. false true _210_ 0 2749 9 It's complicated false none. false Jesse Wu BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K195617 1 BBa_K195617 pTet with activator gene CII and pRE with GFP generator 2009-10-17T11:00:00Z 2015-05-08T01:11:17Z biobrick This part is composed of pTetR with inducer gene CII, and it would induce pRE to produce green fluorescent protein. The coding sequence CII could induce BBa_K116603,the regulatory promoter pRE from &#955; phage. The TetR repressible promoter is repressed by TetR (BBa_C0040).The pRE would be induced by CII produced by the downstream gene of the regulatory promoter pTet and produce green fluorescent protein. false false _292_ 0 4841 9 It's complicated false none false Yun-Hsiang Chang component2050699 1 BBa_B0012 component2050697 1 BBa_B0010 component2050692 1 BBa_K116603 component2050688 1 BBa_B0012 component2050678 1 BBa_R0040 component2050686 1 BBa_B0010 component2050694 1 BBa_B0034 component2050684 1 BBa_B0034 component2050685 1 BBa_K116602 component2050696 1 BBa_E0040 annotation2050699 1 BBa_B0012 range2050699 1 1410 1450 annotation2050686 1 BBa_B0010 range2050686 1 383 462 annotation2050688 1 BBa_B0012 range2050688 1 471 511 annotation2050692 1 BBa_K116603 range2050692 1 520 567 annotation2050697 1 BBa_B0010 range2050697 1 1322 1401 annotation2050684 1 BBa_B0034 range2050684 1 63 74 annotation2050694 1 BBa_B0034 range2050694 1 576 587 annotation2050696 1 BBa_E0040 range2050696 1 594 1313 annotation2050685 1 BBa_K116602 range2050685 1 81 374 annotation2050678 1 BBa_R0040 range2050678 1 1 54 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K116603 1 pRE pRE promoter from &#955; phage 2008-10-29T12:00:00Z 2015-05-08T01:09:33Z &#955; phage The pRE coding region from &#955; phage. It is able to be induced by CII (BBa_K116602). false false _210_ 0 2749 9 It's complicated false none. false Jesse Wu BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K116603_sequence 1 agagcctcgttgcgtttgtttgcacgaaccatatgtaagtatttcctt BBa_K116602_sequence 1 atggttcgtgcaaacaaacgcaacgaggctctacgaatcgagagtgcgttgcttaacaaaatcgcaatgcttggaactgagaagacagcggaagctgtgggcgttgataagtcgcagatcagcaggtggaagagggactggattccaaagttctcaatgctgcttgctgttcttgaatggggggtcgttgacgacgacatggctcgattggcgcgacaagttgctgcgattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatggagttctga BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K195617_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatggttcgtgcaaacaaacgcaacgaggctctacgaatcgagagtgcgttgcttaacaaaatcgcaatgcttggaactgagaagacagcggaagctgtgggcgttgataagtcgcagatcagcaggtggaagagggactggattccaaagttctcaatgctgcttgctgttcttgaatggggggtcgttgacgacgacatggctcgattggcgcgacaagttgctgcgattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatggagttctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagcctcgttgcgtttgtttgcacgaaccatatgtaagtatttcctttactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z