BBa_K1957002 1 BBa_K1957002 HydB (C-terminally tagged) subunit of FeFe Hydrogenase 2016-10-05T11:00:00Z 2016-10-06T10:16:32Z The source of the part will be its sequence which was retrieved from GenBank. One of the three subunits that make up FeFe Hydrogenase in Shewanella oneidensis. Specifically this is the HydB subunit which is the central subunit. This basic part has a strep-tag attached to its C-terminus for consequent protein assays. This unit is one out of the three subunits that can be used to make a the entire FeFe hydrogenase construct. false false _2424_ 32225 32225 9 false This is one of of the three FeFe Hydrogenase subunits. To make the entire FeFe Hydrogenase construct the following BioBricks need to be ligated with BBa_K1957002: BBa_K1957004 and BBa_K1957001. pSB1C3 would not conjugate properly into S.oneidensis, thus the three subunits were ligated using golden gate cloning into the pBAD expression vector. false Nancy Teng BBa_K1957002_sequence 1 ggtctcgaatgaacaagaaaaaacacctatttgccgaggacagtttctttctgtcacgccgtaaatttatggctgtcggtgccgcgtttgtggccgcactcgcgatccccatcggctggtttaccagcaagcttgaacgccgtaatgagtacattaaggccagaagccaagggctatacaaggacgacagcctagcaaaaacccgcgtcagccatgctaaccccgcggtagaaaagtactacaaagagttcggtggcgagccattaggacatatgtcccacgagctactgcacacccactttgtcgatcgcaccaaattaagctcttggagccatccacaattcgagaagtgattggagatgagaaacgagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z