BBa_K1957006 1 BBa_K1957006 HyaC subunit of NiFe Hydrogenase 2016-10-12T11:00:00Z 2016-10-14T11:19:18Z The source of the part will be its sequence which was retrieved from GenBank. One of the three subunits that make up NiFe Hydrogenase in Shewanella oneidensis. Specifically this is the HyaC subunit, which is the outer periplasmic subunit. This gene encodes one out of the three subunits that can be used to make the entire NiFe hydrogenase construct. false false _2424_ 32225 32225 9 false This is one of of the three NiFe Hydrogenase subunits. The entire NiFe construct can be made by ligating the remaining units into the pBAD expression vector via golden gate cloning. For the entire NiFe hydrogenase cluster the following BioBricks need to be ligated with Bba_K1957006: Bba_K1957005 with Bba_K1957007 or Bba_K1957005 with Bba_K1957008 BBa_J04450, which contained pSB1C3, would not conjugate properly into S.oneidensis, most likely due to conflicts in the origin of replication. The conflict could result in low copy numbers of pSB1C3 in S.oneidensis resulting in little antibiotic resistance. pSB1C3 contains pUC19 derived pMB1 origin of replication. In a paper by Myers and Myers (1997) they observed that pMB1 did not replicate in Shewanella oneidensis MR-1, formerly known as Shewanella putrefaciens MR-1. To overcome this issue, the three subunits were ligated into the pBAD expression vector using Golden Gate cloning false Nancy Teng BBa_K1957006_sequence 1 ggtctccacatgaaccattctgaaacccgcattcggacactggtttttagtcccgcaatacggattttccactggttacgagcactgacgattttagtgctggtgatcaccggattctatattgcttggccgtttcttgtggcgcccgaaagcacggatgtattagtacaaggttggatccgttttgcccatttgatctgcggttttatcttaaccgcagtcaccttggcccgcttctacttgtattttttcagtcgtagcaatatcgaacggcgctcgtttcgtgatgtgatgagtattaagagctggattacccaactaaaatcttacatttggatggggcatttacataaagctggcgtttacgggccactgcaatttgtgacatatgtagcaatctcctttgttgcgcttgtgatatgtattactggcctcgtactgtatgccaatgtctaccatgaaggtttaggtggcatgctttggagcagtgcagcttggatcacggcgcaaatgggtggactggctcaggtgagaatttggcaccactacctcacttgggcattcgttatctttgtggttatccacgtctacatggcggtttggtcagggatacgcttcaaacataactcagttgactcaattgtctctggttacgactacccgaaaccagactcacaccattagtggaggagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z