BBa_K1958000 1 HyaE -> E HyaE -> E. coli 2016-10-11T11:00:00Z 2016-10-12T09:20:37Z Escherichia coli BL21 HyaE is a subunit of hydrogenase 1 (Hyd-1) from Escherichia coli genome. The hya operon, which contains gene for the two HYD1 structual subunits and four additional genes (HyaA-F) was mapped at 22min on the E.coli chromosome. And hyaE is the fifth gene of hya operon, sharing the first few base pairs with hyaD and the last few base pairs with hyaF. HyaE is a hydrogenase maturase. It is important to note that hyaE is not required for the assembly of standard O2-sensitive hydrogenases (Hyd-2 and others) and are apparently only involved in the assembly of O2-tolerant respiratory enzymes. false false _2425_ 21319 21319 9 true None. false Wei Wei annotation2493922 1 ATG start codon range2493922 1 1 3 annotation2493925 1 TGA stop codon range2493925 1 397 399 annotation2493923 1 HyaE coding region range2493923 1 1 399 BBa_K1958000_sequence 1 atgagcaacgacacgccatttgatgcgttgtggcaacgaatgctggcgcgcggctggacgccagtcagtgaatcccgtcttgacgactggcttacgcaagcgccagacggcgtggtgttattaagcagtgacccgaaacgcacgccagaggtcagcgataatccggtaatgattggcgaattactgcgcgagtttcccgactatacatggcaggtggcgattgctgaccttgagcagagcgaagccatcggcgatcgctttggcgtctttcgctttcctgccactttagtgtttaccggcggaaactatcgcggcgtgctgaatggtattcacccgtgggcggaactgataaacctgatgcgcgggcttgtcgaaccgcagcaggagcgtgcctcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z