BBa_K1958004 1 HyaD -> E HyaD -> E. coli 2016-10-11T11:00:00Z 2016-10-12T09:15:44Z Escherichia coli BL21 HyaD is a subunit of hydrogenase 1 (Hyd-1) from Escherichia coli genome. The hya operon, which contains gene for the two HYD1 structual subunits and four additional genes (HyaA-F) was mapped at 22min on the E.coli chromosome. And hyaD is the fourth gene of hya operon, sharing the first few base pairs with hyaC and the last few base pairs with hyaE. HyaD is the specific protease required for large subunit maturation-terminal processing. HyaD is a hydrogenase maturase. false false _2425_ 21319 21319 9 true None. false Wei Wei annotation2493919 1 TGA stop codon range2493919 1 586 588 annotation2493911 1 ATG start codon range2493911 1 1 3 annotation2493912 1 HyaD coding region range2493912 1 1 588 BBa_K1958004_sequence 1 atgagcgagcaacgcgtggtggtcatggggctgggcaacctgctgtgggccgatgaaggcttcggcgtgcgggtggcggaacggctgtatgcccattaccactggcccgagtatgtggagattgtcgatggcggtactcagggactgaacttgctggggtatgtcgaaagcgccagccatctgttgattctcgatgccattgactacgggctggaacctggaacgctgcgaacctatgccggagaacgcattccggcttatctcagcgcgaagaaaatgagcctgcatcagaacagtttctccgaagtgttggcgctggcggatatccgcggacatctgccagcacatattgccctcgtcggtctgcaacccgcaatgctcgacgactacggcggtagcctgagcgaactggcacgggagcaactgcccgctgcggaacaggcggcgctggcgcagcttgctgcgtggggaattgtgccgcaaccggctaatgaatcgcgctgtctcaattatgactgtctgtcgatggaaaattacgaaggcgttcgcttgcgccagtaccggatgacacaggaggagcagggatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z