BBa_K1958006 1 HyaF -> E HyaF -> E. coli 2016-10-11T11:00:00Z 2016-10-12T09:27:51Z Escherichia coli BL21 HyaF is a subunit of hydrogenase 1 (Hyd-1) from Escherichia coli genome. The hya operon, which contains gene for the two HYD1 structual subunits and four additional genes (HyaA-F) was mapped at 22min on the E.coli chromosome. And hyaE is the sixth gene of hya operon, sharing the first few base pairs with hyaD and the last few base pairs with hyaF. HyaF is a hydrogenase maturase. Similar to hyaE, hyaF is not required for the assembly of standard O2-sensitive hydrogenases (Hyd-2 and others) and are apparently only involved in the assembly of O2-tolerant respiratory enzymes. HyaF interacts with HyaE to form a complex together with the small subunit during assembly. false false _2425_ 21319 21319 9 true None. false Wei Wei annotation2493965 1 TAA stop codon range2493965 1 856 858 annotation2493963 1 ATG start codon range2493963 1 1 3 annotation2493964 1 HyaF coding region range2493964 1 1 858 BBa_K1958006_sequence 1 atgagcgaaacttttttccatctgctggggccaggaacgcaaccgaacgatgacagtttcagcatgaatccactgccgatcacctgtcaggtgaatgatgaaccgagtatggcggccctggagcaatgtgctcacagcccgcaggtgattgcgctgttaaacgagttacaacatcaactaagcgaacgccaaccgccgttgggcgaggtgctggcagtcgatctgttaaatctcaacgccgacgatcgtcactttatcaatacgcttctcggggaaggggaagtgtcagtgcgcattcagcaggctgacgacagtgaaagtgaaatacaggaggcgatcttctgcggattatggcgggtgcgcagacgtcgcggcgaaaagttgctggaggacaaactggaggctggctgcgcgccgctggcgttgtggcaggcggcaacgcaaaatctcttgccgacagattcgctgttaccgccgcccattgatggcctgatgaatggcctaccgttggcgcatgagttactggcacatgtacgtaaccccgacgcgcagccgcacagcattaatctgacgcaattacccatcagcgaggctgatcggctttttctctcacgtctctgtgggccgggaaatattcagattcgtaccattggctatggcgagagctatatcaacgccacggggttacgccatgtctggcatttacgctgtacggacaccttaaaaggcccgttactggaaagttatgaaatctgcccaataccggaagtggtgctggcagcgccagaagatttggtcgactctgcgcagcggcttagcgaggtatgtcagtggctggcggaagctgcaccgacgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z