BBa_K1958007 1 PbrR -> C. PbrR -> C. metallidurans 2016-10-11T11:00:00Z 2016-10-12T09:35:51Z Cupriavidus metallidurans CH34 PbrR is amplified from Cupriavidus metallidurans CH34 (formerly Ralstonia metallidurans) genome. PbrR, together with its homologues in the same bacterium, are the only known lead(II)-specific binding protein found in nature. PbrR binds lead(II) 1000-fold more selectively over other metal ions such as mercury(II), zinc(II), copper(II), nickel(II), and silver(I). Besides lead(II), PbrR also shows the binding capacity of cadmium(II), but slightly lower than that of lead(II). The binding capacity may be concerned with three conserved Cys residues: Cys78, Cys113 and Cys122. Because the gene encoding PbrR contains a digest site of Pst I (-CTGCAG-), to fit the construction of standard biobrick, we change those site from -CTGCAG- to -CTGCAA- by point mutation. false false _2425_ 21319 21319 9 true None. false Wei Wei annotation2493974 1 PbrR coding region range2493974 1 1 438 annotation2493981 1 TAG stop codon range2493981 1 436 438 annotation2493972 1 ATG start codon range2493972 1 1 3 BBa_K1958007_sequence 1 atgaatatccagatcggcgagcttgccaagcgcaccgcatgcccggtggtgaccattcgcttctacgaacaagaagggctgttgccgccgccgggccgcagccgggggaattttcgcctgtatggcgaggagcacgtggagcgcttgcagttcattcgtcactgccggtctctggatatgccgttgagcgacgtacggaccttattgagttaccggaagcggcccgaccaggattgcggtgaagtcaatatgctcttagatgagcacatccgtcaggtcgaatctcggatcggagccttgctcgaactgaagcaccatttggtggaactgcgcgaagcctgttctggtgccaggcccgcccaatcgtgcgggattctgcaaggactgtcggactgcgtgtgtgatacgcgggggaccaccgcccatccaagcgactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z