BBa_K196001 1 BBa_K196001 CcdA antidote with the mob promoter (forward) 2009-08-10T11:00:00Z 2015-05-08T01:11:17Z This part comes from the StabyTM plasmid, designed by Delphi Genetics. Stabilization system : Higher plasmid stability = More proteins Principle: In the StabyExpressTM system, the antidote gene (ccdA) is introduced in the plasmid DNA under the control of a weak constitutive promoter : the mob promoter, which doesn???t come from E. coli but from a broad host range plasmid (pBHR1) . On the other hand, the toxic gene (ccdB) is introduced in the chromosome of the bacteria, which can be furnished by DelphiGenetics. Expression of the poison gene is under the control of a promoter strongly repressed in the presence of the plasmid. When the plasmid is lost, the antidote is degraded and the production of the toxin is induced, causing cell death. Practically this means that when during the pre-induction phase bacteria are grown, 100% of the bacteria will carry the vector. If they lose the vector, they will not obtain a growth advantage, but will die. Upon induction 100% of the bacteria will start producing the recombinant protein leading to higher yields of the target protein and less background caused by unwanted proteins. For manufacturers of recombinant proteins this system offers a great benefit because it is an antibiotic free expression system. Therefore the manufactured protein will also be free of traces of antibiotics. For more information, please visit the Delphi Genetics. false false _309_ 0 4813 9 It's complicated false Initially, the ccdA sequence was introduced in the plasmid in the reversed way. In order to leave the possibility to use it in both ways, we also designed this part in the forward way. false Laetitia Warny annotation2017206 1 mob (putative) range2017206 1 154 159 annotation2017208 1 putative RBS range2017208 1 251 255 annotation2017207 1 mob (putative) range2017207 1 174 179 annotation2017209 1 ccdA range2017209 1 263 481 BBa_K196001_sequence 1 tgtccacgggccgagcgaagcgagccagccggtggccgctcgcggccatcgtccacatatccacgggctggcaagggagcgcagcgaccgcgcagggcgaagcccggagagcaagcccgtagggcgccgcagccgccgtaggcggtcacgactttgcgaagcaaagtctagtgagtatactcaagcattgagtggcccgccggaggcaccgccttgcgctgcccccgtcgagccggttggacaccaaaagggaggggcaggcatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatacgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z