BBa_K196003 1 HfsH HfsH protein from <i>Caulobacter crescentus</i> 2009-08-11T11:00:00Z 2015-05-08T01:11:17Z This sequence comes from Caulobacter crescentus. Caulobacter crescentus is an aquatic, Gram-negative bacterium that divides asymmetrically and is able to synthetize a strong glue. This glue is mainly made of a polysaccharide. There are different proteins needed to synthetize, export and attach it to the stalk of Caulobacter. To see the hole system, please see this page. In our project, we would like this glue to be produced by Escherichia coli. As E. coli does have homolog genes for many of these proteins, but not for HfsG and HfsH, we decided to create a plasmid including only the genes coding for these two proteins. HfsG is a glycosyltransferase and HfsH is a carbohydrate esterase. Here you have HfsH. false false _309_ 0 4813 9 It's complicated false As many mutations were needed to make the part compatible with the standard 10, we decided to make it synthetized by GeneArt. false Laetitia Warny BBa_K196003_sequence 1 atgccgatggagttcgaaaaagtagatgcttatgaaccagaccgcagcctgaaaggcaaactgcgtcgccgtctgatccgtctggcacaccgccgtccagcaaaagtggctctggaacgtccgatggtgtctttctccttcgacgacgcgccagcaactgcttgcgaagctggcgcacgtgctctggaagctcgtggcctgcgtggcacctactatttcgctgctggtctgaccggccgtgacggccctatgggccgctatgcaactggtgaggacgcacgtcgtctgcacgaagccggtcacgaaatcgcttgccacacctactcccacctggattgtggtcagtcttctcagaccgaaaccctggctgatgtcgatcgtaatgccgaaagcctggcggcttggggtgcaggcgatccggtgtcttttgcctacccgtacggtgatgtggctgctccggctaaaacggctctgtctggtcgttttaaaactctgcgcgctctgcaccacggcctgatcaccgacggcgcagatctgaaccagactccggcagtaggcatcgaaggtgaagatggtgaaaccgttgccaaggcatggctggataaggcgaaggcacgtaaagcctggctgatcctgtatacgcacgacgtcgcaggccagcctagccagtggggttgcaccacggaagcgctggaacgcctgatcgaccgtgctctggcggacggcttcgacgttgtgacggtagccgaaggttctcgtcgtatcggcctgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z