BBa_K1960900 1 BBa_K1960900 P2 promoter with RBS 2016-09-28T11:00:00Z 2016-09-29T08:40:12Z We got the sequence from parts.igem.org, designed the whole sequence and add BioBrick prefix and suffix using SnapGene. The part was synthetised by Sangon Biotech??, Shanghai, China. This part is the promoter, P2 with BBa_B0034, a useful RBS. The agr P2 operon is an autocatalytic sensory transduction system in Staphylococcus aureus. P2 promoter regulates the synthesis of AgrB (a transmembrane protein) and AgrD (precursor of AIP autoinducing peptide). AIP binds to AgrC, a membrane binding receptor and it phosphorylates AgrA. The phosphorylated AgrA increases the activity of agr P2 promoter about 50-fold. The cell density at which the agr system is activated is determined by the AgrA-independent activity of P2 promoter The basal agr P2 promoter activity is high enough to make stochastic effects negligible. (E. Gustafsson et al. 2004) false false _2427_ 31248 31248 9 false The part BBa_I746104 on 2016 DNA Kit Plate is inconsistent, so we had to synthetise this part ourselves. false Rengwei Liu component2485450 1 BBa_I746104 component2485452 1 BBa_B0034 annotation2485452 1 BBa_B0034 range2485452 1 105 116 annotation2485450 1 BBa_I746104 range2485450 1 1 96 BBa_I746104 1 BBa_I746104 P2 promoter in agr operon from S. aureus 2007-08-30T11:00:00Z 2015-08-31T04:08:04Z The section of the sequence constituting the P2 promoter is subject to rather more debate than the sequences of the coding regions. [http://jb.asm.org/cgi/content/full/186/22/7549 Koenig, Robbin L., Ray, Jessica L., Maleki, Soheila J., Smeltzer, Mark S., Hurlburt, Barry K. Staphylococcus aureus AgrA Binding to the RNAIII-agr Regulatory Region J. Bacteriol. 2004 186: 7549-7555] shows the areas of the sequence to which phosphorylated AgrA binds while L Rao, R K Karls, and M J Betley: In vitro transcription of pathogenesis-related genes by purified RNA polymerase from Staphylococcus aureus. Bacteriol. 1995 May; 177(10): 2609???2614. shows the transcription start sites; we took the overall extent of the promoter region from that labelled in Morfeldt, E., K. Tegmark, and S. Arvidson. 1996. Transcriptional control of the agr-dependent virulence gene regulator, RNAIII, in Staphylococcus aureus. Mol. Microbiol. 21:1227???1237. (not available online). Released HQ 2013 The agr P2 operon is an autocatalytic sensory transduction system in Staphylococcus aureus. P2 promoter regulates the synthesis of AgrB (a transmembrane protein) and AgrD (precursor of AIP autoinducing peptide). AIP binds to AgrC, a membrane binding receptor and it phosphorylates AgrA. The phosphorylated AgrA increases the expression level from P2 promoter. false false _116_ 0 2121 9 In stock false Codon usage has been optimised for E. coli (which also seems to give good results for B. subtilis true Zhizhen Zhao BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I746104_sequence 1 attaaatacaaattacatttaacagttaagtatttatttcctacagttaggcaatataatgataaaagattgtactaaatcgtataatgacagtga BBa_B0034_sequence 1 aaagaggagaaa BBa_K1960900_sequence 1 attaaatacaaattacatttaacagttaagtatttatttcctacagttaggcaatataatgataaaagattgtactaaatcgtataatgacagtgatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z