BBa_K880005 1 BBa_K880005 Strong promoter, strong RBS combination for high expression levels of proteins 2012-09-28T11:00:00Z 2015-05-08T01:13:40Z It is a combination of strong promoter (J23100) and RBS (B0034). Released HQ 2013 -J23100+B0034 -Strong promoter, strong RBS combination for high expression levels of proteins Consensus constitutive promoter and RBS sequence-produces strongest possible expression. false false _1142_ 0 9403 9 In stock false Enter design considerations. false Josh Atkinson, Mike Ferguson, and Ben Parker component2204230 1 BBa_B0034 component2204228 1 BBa_J23100 annotation2204230 1 BBa_B0034 range2204230 1 44 55 annotation2204228 1 BBa_J23100 range2204228 1 1 35 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1961002 1 BBa_K1961002 RecO protein-SOS mediator protein 2016-10-02T11:00:00Z 2016-10-20T11:53:56Z NCBI The RecO protein is involved in DNA metabolism; it is required for DNA replication and normal SOS inducibility. When DNA is damaged and forms single-stranded DNA, Rec A binds single-stranded DNA (ssDNA). The binding of RecA onto ssDNA forms a nucleoprotein filament that promotes LexA cleavage (thereby inducing the SOS response). Recombinase mediator proteins RecF, RecO, and RecR act together to promote loading of RecA onto single stranded DNA. false false _2428_ 32606 32606 9 false No false Yi-Ting Lin BBa_K1961009 1 BBa_K1961009 RecO protein generator 2016-10-13T11:00:00Z 2016-10-14T10:48:43Z We ligased K1961002 with K880005 RecO protein-SOS mediator protein. It is involved in the RecFOR pathway for DNA metabolism; it is required for DNA replication and normal SOS inducibility false false _2428_ 32606 32606 9 false No false Yi-Ting Lin component2507026 1 BBa_K1961002 component2507025 1 BBa_K880005 annotation2507025 1 BBa_K880005 range2507025 1 1 55 annotation2507026 1 BBa_K1961002 range2507026 1 62 790 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1961009_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatggaaggctggcagcgcgcatttgtcctgcatagtcgcccgtggagcgaaaccagcctgatgctggacgtcttcacggaggaatcggggcgcgtgcgtctggttgccaaaggcgcacgctctaaacgctctaccctgaaaggtgcattacagcctttcacccctctcttgctacgttttggcgggcgtggcgaagtcaaaacgctgcgcagtgctgaagccgtctcgctggcgctgccattaagcggtatcacgctttacagcggtctgtacatcaacgaacttctctcccgcgtactggaatacgagacgcgcttctctgaactttttttcgattacttgcactgcattcagtctcttgcaggggtcactggtacgccagaacccgcgctgcgccgctttgaactggcactgctcgggcatctgggttatggcgtcaattttacccattgtgcgggtagcggcgagccggtagatgacaccatgacgtatcgttatcgcgaagaaaaagggtttatcgcaagcgtcgttatcgacaataaaacgttcaccggaaggcagttaaaagcgttaaacgcacgggaatttcctgacgcagacacactgcgcgccgcgaaacgctttacccgcatggcgcttaagccgtatcttggcggtaaacctttaaagagcagggaactgttccggcagtttatgcctaagcgaacggtgaaaacacattatgaatga BBa_B0034_sequence 1 aaagaggagaaa BBa_K1961002_sequence 1 atggaaggctggcagcgcgcatttgtcctgcatagtcgcccgtggagcgaaaccagcctgatgctggacgtcttcacggaggaatcggggcgcgtgcgtctggttgccaaaggcgcacgctctaaacgctctaccctgaaaggtgcattacagcctttcacccctctcttgctacgttttggcgggcgtggcgaagtcaaaacgctgcgcagtgctgaagccgtctcgctggcgctgccattaagcggtatcacgctttacagcggtctgtacatcaacgaacttctctcccgcgtactggaatacgagacgcgcttctctgaactttttttcgattacttgcactgcattcagtctcttgcaggggtcactggtacgccagaacccgcgctgcgccgctttgaactggcactgctcgggcatctgggttatggcgtcaattttacccattgtgcgggtagcggcgagccggtagatgacaccatgacgtatcgttatcgcgaagaaaaagggtttatcgcaagcgtcgttatcgacaataaaacgttcaccggaaggcagttaaaagcgttaaacgcacgggaatttcctgacgcagacacactgcgcgccgcgaaacgctttacccgcatggcgcttaagccgtatcttggcggtaaacctttaaagagcagggaactgttccggcagtttatgcctaagcgaacggtgaaaacacattatgaatga BBa_K880005_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z