BBa_K1962001 1 BBa_K1962001 Immunity Protein Im-Ia 2016-10-10T11:00:00Z 2016-10-11T03:07:20Z This part was designed by back-translation of the primary amino acid sequence into DNA sequence, followed by optimisiation for expression in an E. coli chassis. The biobrick was then synthesised de novo by IDT. This biobrick codes for the Immunity Protein for Colicin Ia (<partinfo>BBa_K1962000</partinfo>). Colicin Ia is a channel-forming bacteriocin that depolarizes the cytoplasmic inner membrane of target bacteria, leading to dissipation of cellular energy. This Immunity Protein is tightly linked to its specific Colicin bacteriocin domain to protect the colicinogenic cell from the cytotoxic activity of the colicin. false false _2429_ 8083 8083 9 false Compliant with RFC[10]. false Frank Sargent annotation2491784 1 Immunity Protein Im-Ia range2491784 1 1 333 BBa_K1962015 1 BBa_K1962015 A device for expression of Im-Ia in response to pH 2016-10-11T11:00:00Z 2016-10-12T03:50:34Z Existing and new biobricks were combined using the RFC[10] standard. This is a composite part for the production of the Immunity Protein to Colicin Ia in response to environmental pH changes. The composite part consists of a pH sensitive promoter (<i>asr</i> from biobrick <partinfo>BBa_K1231000</partinfo>, an RBS (<partinfo>BBa_B0030</partinfo>) and the Immunity Protein required to neutralise the bacteriocin activity of Colicin Ia (<partinfo>BBa_K1962001</partinfo>). false false _2429_ 8083 8083 9 false RFC[10] compliant. false Frank Sargent component2493643 1 BBa_B0030 component2493641 1 BBa_K1231000 component2493646 1 BBa_K1962001 annotation2493641 1 BBa_K1231000 range2493641 1 1 140 annotation2493643 1 BBa_B0030 range2493643 1 149 163 annotation2493646 1 BBa_K1962001 range2493646 1 170 502 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_K1231000 1 BBa_K1231000 The asr promoter is a pH-responsive promoter. 2013-09-12T11:00:00Z 2015-05-08T01:09:44Z E. coli This part contains the asr promoter with its native RBS. The asr promoter is a pH-responsive promoter native to E. coli. It induces transcription in acidic conditions (~pH 5.5). false false _1545_ 0 18773 9 In stock false None. false Viral Patel BBa_K1962015_sequence 1 cgctgtaatttattcagcgtttgtacatatcgttacacgctgaaaccaaccactcacggaagtctgccattcccagggatatagttatttcaacggccccgcagtggggttaaatgaaaaaacaaattgagggtatgacatactagagattaaagaggagaaatactagatgaaccgtaaatactacttcaacaacatgtggtggggttgggttaccggtggttacatgctgtacatgtcttgggactacgagttcaaataccgtctgctgttctggtgcatctctctgtgcggtatggttctgtacccggttgcgaaatggtacatcgaagacaccgcgctgaaattcacccgtccggacttctggaactctggtttcttcgcggacaccccgggtaaaatgggtctgctggcggtttacaccggtaccgttttcatcctgtctctgccgctgtctatgatctacatcctgtctgttatcatcaaacgtctgtctgttcgt BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1962001_sequence 1 atgaaccgtaaatactacttcaacaacatgtggtggggttgggttaccggtggttacatgctgtacatgtcttgggactacgagttcaaataccgtctgctgttctggtgcatctctctgtgcggtatggttctgtacccggttgcgaaatggtacatcgaagacaccgcgctgaaattcacccgtccggacttctggaactctggtttcttcgcggacaccccgggtaaaatgggtctgctggcggtttacaccggtaccgttttcatcctgtctctgccgctgtctatgatctacatcctgtctgttatcatcaaacgtctgtctgttcgt BBa_K1231000_sequence 1 cgctgtaatttattcagcgtttgtacatatcgttacacgctgaaaccaaccactcacggaagtctgccattcccagggatatagttatttcaacggccccgcagtggggttaaatgaaaaaacaaattgagggtatgaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z