BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_K1962004 1 BBa_K1962004 Immunity Protein Im-E3 2016-10-10T11:00:00Z 2016-10-11T06:18:10Z The primary protein sequence was obtained from Uniprot and then back translated into DNA before being codon optimised for E. coli K-12 and synthesised by IDT as a gBlock. This biobrick encodes for the Immunity protein specific for Colicin E3. This Immunity Protein inhibits the 16S RNA hydrolyzing activity of Colicin E3 by binding with high affinity to the C-terminal catalytic domain of E3. The sequence was obtained from Uniprot and then codon optimised for E. coli K-12 and synthesised by IDT as a gBlock gene fragment. false false _2429_ 8083 8083 9 false Compliant with RFC[10]. false Frank Sargent annotation2491927 1 Immunity Protein Im-E3 range2491927 1 1 255 BBa_K1962016 1 BBa_K1962016 A device for expression of Im-E3 in response to pH 2016-10-11T11:00:00Z 2016-10-12T03:59:01Z Constructed from existing and new biobricks exactly to the RFC[10] standard. This is a composite part for the regulated expression of the Immunity Protein for netralization of the Colicin E3, which is a specific RNase. The composite part was assembled from a pH responsive promoter (<i>asr</i> <partinfo>BBa_K1231000</partinfo>), an RBS (<partinfo>BBa_B0030</partinfo>) and the biobrick encoding the Immunity Protein against E3 (Im-E3) (<partinfo>BBa_K1962004</partinfo>). false false _2429_ 8083 8083 9 false RFC[10] compliant. false Frank Sargent component2493676 1 BBa_B0030 component2493679 1 BBa_K1962004 component2493674 1 BBa_K1231000 annotation2493674 1 BBa_K1231000 range2493674 1 1 140 annotation2493679 1 BBa_K1962004 range2493679 1 170 424 annotation2493676 1 BBa_B0030 range2493676 1 149 163 BBa_K1231000 1 BBa_K1231000 The asr promoter is a pH-responsive promoter. 2013-09-12T11:00:00Z 2015-05-08T01:09:44Z E. coli This part contains the asr promoter with its native RBS. The asr promoter is a pH-responsive promoter native to E. coli. It induces transcription in acidic conditions (~pH 5.5). false false _1545_ 0 18773 9 In stock false None. false Viral Patel BBa_K1962004_sequence 1 atgggtctgaaactggacctgacctggttcgacaaatctaccgaagacttcaaaggtgaagaatactctaaagacttcggtgacgacggttctgttatggaatctctgggtgttccgttcaaagacaacgttaacaacggttgcttcgacgttatcgcggaatgggttccgctgttacaaccgtacttcaaccaccagatcgacatctctgacaacgaatacttcgtttctttcgactaccgtgacggtgactgg BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1962016_sequence 1 cgctgtaatttattcagcgtttgtacatatcgttacacgctgaaaccaaccactcacggaagtctgccattcccagggatatagttatttcaacggccccgcagtggggttaaatgaaaaaacaaattgagggtatgacatactagagattaaagaggagaaatactagatgggtctgaaactggacctgacctggttcgacaaatctaccgaagacttcaaaggtgaagaatactctaaagacttcggtgacgacggttctgttatggaatctctgggtgttccgttcaaagacaacgttaacaacggttgcttcgacgttatcgcggaatgggttccgctgttacaaccgtacttcaaccaccagatcgacatctctgacaacgaatacttcgtttctttcgactaccgtgacggtgactgg BBa_K1231000_sequence 1 cgctgtaatttattcagcgtttgtacatatcgttacacgctgaaaccaaccactcacggaagtctgccattcccagggatatagttatttcaacggccccgcagtggggttaaatgaaaaaacaaattgagggtatgaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z