BBa_K1963002 1 BBa_K1963002 A template for expression of sRNA fusions to the E. coli micC hairpin 2016-10-06T11:00:00Z 2016-10-17T05:25:37Z This was designed de novo and synthesised as a gBlock by IDT for the Dundee_Schools iGEM team in 2016. This is a multi-sequence system for small RNA (sRNA) production in an E. coli host or with co-expression of E. coli Hfq in an alternative host. The system has the proD strong promoter, followed by the micC hairpin, followed by the strin terminator sequence T1/TE. Phosphorylated primers should be used to insert the reverse/complement target sequence of your choice between the promoter and the hairpin sequence. false false _2430_ 8083 8083 9 false The sequence is RFC[10] compliant. false Frank Sargent annotation2514338 1 micC loop range2514338 1 194 271 annotation2514339 1 terminator range2514339 1 272 402 annotation2514319 1 proD promoter range2514319 1 1 193 BBa_K1963002_sequence 1 cacagctaacaccacgtcgtccctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataaggctcgtataatatattcagggagaccacaacggtttccctctacaaataattttgtttaacttttaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggctttttttccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z