BBa_K1963003 1 BBa_K1963003 A template for expression of sRNA fusions to the Serratia chiA hairpin 2016-10-06T11:00:00Z 2016-10-07T02:09:22Z This part was synthesised de novo as a gBlock by IDT for the Dundee_Schools iGEM team 2016. This is a multi-sequence system for small RNA (sRNA) production with co-expression of S. marcescens Hfq. The system has the proD strong promoter, followed by a chiA hairpin sequence from the 3'-end of the S. marcescens chiA gene encoding a chitinase, followed by the strong terminator sequence T1/TE. The use of an S. marcescens chiA hairpin/Hfq pairing should provide very high specificity in chosen chassis organisms. Phosphorylated primers should be used to insert the reverse/complement target sequence of your choice between the promoter and the hairpin sequence. The sRNA should be placed betweeen C-193 and G-194. false false _2430_ 8083 8083 9 false The sequence is RFC[10] compliant. false Frank Sargent annotation2528082 1 chiA hairpin range2528082 1 194 234 annotation2528083 1 terminator range2528083 1 235 368 annotation2528081 1 proD promoter range2528081 1 1 193 BBa_K1963003_sequence 1 cacagctaacaccacgtcgtccctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataaggctcgtataatatattcagggagaccacaacggtttccctctacaaataattttgtttaacttttaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcgttgcagtgcgttgccgggggatatcctttcgcccccggctttttcccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z