BBa_K1963004 1 BBa_K1963004 An sRNA system for down-regulation of E. coli fliC encoding flagellin. 2016-10-06T11:00:00Z 2016-10-23T09:17:38Z This part was generated by PCR using phosphorylated primers and BBa_K1963002 as template. This is a multi-sequence system for small RNA (sRNA) production in an E. coli host - or especially with co-expression of E. coli Hfq. The system is based on the BBa_K1963002 template and has the proD strong promoter, followed by a short antisense sequence targeting the 5' end of the fliC transcript, followed by the E. coli micC hairpin, followed by the strong terminator sequence T1/TE. The anti fliC sRNA is placed betweeen C-193 and T-194. The system should impair motility of E. coli. false false _2430_ 8083 8083 9 true This part is RFC[10] compliant. false Frank Sargent annotation2487509 1 micC loop range2487509 1 219 296 annotation2487507 1 proD promoter range2487507 1 1 193 annotation2487510 1 terminator range2487510 1 297 426 annotation2487508 1 sRNA range2487508 1 194 218 BBa_K1963004_sequence 1 cacagctaacaccacgtcgtccctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataaggctcgtataatatattcagggagaccacaacggtttccctctacaaataattttgtttaacttttaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcgttggtattaatgacttgtgccattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggctttttttccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z