BBa_K1963010 1 BBa_K1963010 An sRNA system for down-regulation of E. coli fliC encoding flagellin 2016-10-13T11:00:00Z 2016-10-23T09:18:27Z This part was generated by PCR using phosphorylated primers and BBa_K1963002 as template. This is a multi-sequence system for small RNA (sRNA) production in an E. coli host - or especially with co-expression of E. coli Hfq BBa_K1963000. The system is based on the BBa_K1963002 template and has the proD strong promoter, followed by a short antisense sequence targeting the RBS and 5' end of the fliC transcript, followed by the E. coli micC hairpin, followed by the strong terminator sequence T1/TE. The anti fliC sRNA is placed betweeen C-193 and T-194. The system should impair motility of E. coli. false false _2430_ 8083 20808 9 true This part is RFC[10] compliant false Fatima Ulhuq annotation2528235 1 proD promoter range2528235 1 1 193 annotation2528238 1 terminator range2528238 1 287 420 annotation2528237 1 micC loop range2528237 1 214 286 annotation2528236 1 sRNA range2528236 1 194 213 BBa_K1963010_sequence 1 cacagctaacaccacgtcgtccctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataaggctcgtataatatattcagggagaccacaacggtttccctctacaaataattttgtttaacttttaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcggataacgcatggcacaagtttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggctttttttccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z