BBa_K1963011 1 BBa_K1963011 An sRNA system for down-regulation of Serratia marcescens fliC encoding flagellin. 2016-10-13T11:00:00Z 2016-10-18T04:16:20Z This part was generated by PCR using phosphorylated primers and BBa_K1963002 as template. This is a multi-sequence system for small RNA (sRNA) production in an Serratia marcescens host - or especially with co-expression of Serratia marcescens Hfq BBa_K1963001. The system is based on the BBa_K1963003 template and has the proD strong promoter, followed by a short antisense sequence targeting the 5' end of the fliC transcript, followed by the S. marcescens chiA hairpin, followed by the strong terminator sequence T1/TE. The anti fliC sRNA is placed betweeen C-193 and T-194. The system should impair motility of S. marcescens. false false _2430_ 20808 20808 9 false N/A false Fatima Ulhuq annotation2528088 1 terminator range2528088 1 272 389 annotation2528085 1 proD promoter range2528085 1 1 193 annotation2528086 1 fliC targeting sRNA range2528086 1 194 229 annotation2528087 1 chiA loop range2528087 1 230 271 BBa_K1963011_sequence 1 cacagctaacaccacgtcgtccctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataaggctcgtataatatattcagggagaccacaacggtttccctctacaaataattttgtttaacttttaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcggaaagctggcacaagtaatcgttgcagtgcgttgccgggggatatcctttcgcccccggctttttcccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z