BBa_K1964000 1 BBa_K1964000 [PanD] Aspartate 1-decarboxylase from C. glutamicum [Codon optimized] 2016-10-13T11:00:00Z 2016-10-21T10:43:12Z Synthesized DNA Sequence. Codon optimized version of the panD gene from C. glutamicum. Encodes for the aspatarte 1-decarboxylase that catalyzes the chemical reaction of L-aspartate to beta-alanine + CO2. The protein consists 136 amino acid residues with a deduced molecular mass of 14.1 kDa. It belongs to the family of lyases, specifically the carboxy-lyases, which cleave carbon-carbon bonds. false false _2431_ 30038 30038 9 false While optimized for codon usage in E. coli we had to consider the biobrick restriction sites of EcoRI, PstI, XbaI, SpeI. We manually altered the sequence to avoid these cut sites. false Patrick Gerlinger BBa_K1964000_sequence 1 atgcttcgcactattttaggttctaaaattcaccgtgcaactgtgactcaagcggatctggattatgtgggttctgtcacgattgatgccgatctggtgcatgccgcaggtttgattgagggggagaaagtagcaatcgtggatatcacgaacggagcacgcctggaaacatacgtaatcgtaggtgacgcaggcactggaaatatttgtattaacggagccgccgcacatttaatcaatcctggcgaccttgtgatcattatgtcctatcttcaagcaactgacgccgaagccaaggcgtatgagccgaagatcgtacatgttgatgcagataaccgcatcgtggcacttgggaatgatctggcagaggcgcttcccggaagcggacttttgacaagtcgttctatctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z