BBa_K1964002 1 BBa_K1964002 FliC signal sequence 2016-10-13T11:00:00Z 2016-10-14T12:48:22Z E. coli MG1655 gDNA FliC encodes for Flagellin, the main compound of the E. coli flagellum. The 178bp FliC signal sequence directs it to the cell membrane, where it usually gets integrated. In order to utilize this highly regulated mechanism, we generated a FliCD-knockout E. coli strain. This enabled us to fuse the signal sequence to the N-terminal end of our protein of interest, which as a result got exported and secreted into the medium. false false _2431_ 30038 30038 9 false Requires the design of an E. coli strain where FliC and FliD are both knocked out. false Patrick Gerlinger BBa_K1964002_sequence 1 cgggaataaggggcagagaaaagagtatttcggcgactaacaaaaaatggctgtttttgaaaaaaattctaaaggttgttttacgacagacgataacagggttgacggcgattgagccgacgggtggaaacccaatacgtaatcaacgacttgcaatataggataacgaatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z