BBa_K1965011 1 BBa_K1965011 P5:cLuc 2016-10-16T11:00:00Z 2016-10-18T05:27:08Z cLuc - Photinus pyralis (Common eastern firefly)<br> P5 - artificial sequence This is a coiled coil peptide attached to C-terminal of split luciferase. The coiled coil paires with AP6; upon dimerization the split luciferase reconstitutes and regains activity, resulting in bioluminescence. false false _2432_ 26210 29974 9 false / false Katja Leben annotation2516694 1 stop range2516694 1 352 354 annotation2516692 1 HA-tag range2516692 1 325 351 annotation2516686 1 GS-linker range2516686 1 103 132 annotation2516689 1 cLuc range2516689 1 133 315 annotation2516688 1 P5 range2516688 1 4 102 annotation2516687 1 start range2516687 1 1 3 BBa_K1965011_sequence 1 atgagcccggaggatgagaatgcggcgttggaggagaagatagcgcagttgaagcagaagaatgcggcgttgaaggaggagatacaggcgttggagtatgggggcggctctggcggcggctccggaggctctaccatgaccgagaaggagatcgtggactatgtggccagccaggttacaaccgccaagaagctgcgcggtggtgttgtgttcgtggacgaggtgcctaaaggactgaccggcaagttggacgcccgcaagatccgcgagattctcattaaggccaagaagggcggcaagatcgccgtgaatagtggttctggatacccatacgatgttccagattacgcttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z