BBa_K1967011 1 BBa_K1967011 5_BA BabbleBrick (1.5) 2016-10-17T11:00:00Z 2016-10-18T03:17:00Z Designed de novo by Edinburgh UG iGEM 2016 This is a data encoding PhytoBrick that represents the digit '5' with relevant optimal rectangular code, with BA type hangs. BabbleBrick format 1.5 contains: - A disjunctive word coding region to allow finer control over sequence and prevent the appearance of restriction sequences. - A consolidated stop-codon region with stop codons in every possible frame on both the 3' and 5' strand. - A staggered array of optimal rectangular code for error correction false false _2434_ 30317 30317 9 false Many considerations were taken into account during the design of BabbleBricks. The 1.5 format version has special considerations to make sure that there is a stop codon present in each from of every BabbleBrick to help prevent unwanted protein formation. Additionally, gap regions were placed throughout the BabbleBrick to prevent the formation of restriction sites. Cut sites illegal in PhytoBricks and BioBricks are also illegal to have in BabbleBricks, however it is more difficult to control their appearance because every BabbleBrick has a unique word coding and orc region. By introducing gap sequences, we have greater control over the whole sequence and can prevent any unwanted sites from forming. For more information on the format and evolution of the BabbleBrick, see our wiki page on design: http://2016.igem.org/Team:Edinburgh_UG/Design false Brendan Largey BBa_K1967011_sequence 1 cgctattaatttagctaatcacttatgaaaggagttatggatttaaggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z