BBa_K1968000 1 BBa_K1968000 PA1lac0-1 Phytobrick 2016-10-05T11:00:00Z 2016-10-17T10:52:50Z Ordered as gblock through IDT Derived from the PA1 promoter of bacteriophage T7, PA1lac0-1 is a LacI-dependent promoter and Isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible promoter that has been shown to bring about an 8-fold induction in both E. coli and Synechocystis (Guerrero et al., 2012). Guerrero, F., Carbonell, V., Cossu, M., Correddu, D., & Jones, P. R. (2012). Ethylene synthesis and regulated expression of recombinant protein in Synechocystis sp. PCC 6803. PLoS One, 7(11), e50470. doi: 10.1371/journal.pone.0050470 false false _2435_ 9146 30109 9 false The sequence of this part did not need to be re-designed. false Paolo Marangio annotation2486739 1 PA1lac0-1 range2486739 1 5 76 annotation2492815 1 Phytobrick Adapter Site A range2492815 1 1 4 annotation2492816 1 Phytobrick Adapter Site B range2492816 1 77 80 BBa_K1968000_sequence 1 ggagaaagagtgttgacttgtgagcggataacaatgatacttagattcaattgtgagcggataacaatttcacacatact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z