##gff-version 3
##sequence-region BBa_K1968002 1 23
BBa_K1968002	.	sequence_feature	20	23	.	+	0	ID=annotation2495269;Name=Phytobrick Adapter Site C
BBa_K1968002	.	sequence_feature	1	4	.	+	0	ID=annotation2495268;Name=Phytobrick Adapter Site B
BBa_K1968002	.	ribosome_entry_site	5	19	.	+	0	ID=annotation2514625;Name=RBS*
BBa_K1968002	.	non_covalent_binding_site	9	13	.	+	0	ID=annotation2489370;Name=Core anti-SD motif
BBa_K1968002	.	non_covalent_binding_site	15	19	.	+	0	ID=annotation2489371;Name=Extra 5 bp for easier binding of ribosome to RBS
>BBa_K1968002
tacttagtggaggttactaaatg