BBa_K1968008 1 ErmE ErmE promoter Phytobrick 2016-10-11T11:00:00Z 2016-10-19T03:05:34Z This part was extracted through PCR from pCRISPR-Cas9 vector (GenBank accession number KR011749) (Tong et al., 2015) and was assembled into the PhytoBricks Universal Acceptor (BBa_P10500 or pUPD2). The sequence of this part was confirmed by Sanger Sequencing. A widely used constitutive promoter, ErmE (promoter region of erythromycin-resistance gene) was isolated from Streptomycin (Bibb et al., 1985). It works with related gram positive actinobacteria, such as Rhodococcus. We have this part in pUPD2, a MoClo-compatible level 0 vector with no illegal sites for MoClo assembly standard, GoldenBraid assembly standard and iGEM???s pairwise assembly standard. References: Bibb, M.J., Janssen, G.R. and Ward, J.M., 1985. Cloning and analysis of the promoter region of the erythromycin resistance gene (ermE) of Streptomyces erythraeus. Gene, 38, pp.215-226. Tong, Y., Charusanti, P., Zhang, L., Weber, T. and Lee, S.Y., 2015. CRISPR-Cas9 based engineering of actinomycetal genomes. ACS synthetic biology, 4, pp.1020-1029. false false _2435_ 30015 30015 9 false The part was integrated in reverse and we advise the user to use the reverse complement sequence for downstream applications. false Ibrahim Al-Masoud annotation2494637 1 ErmE range2494637 1 5 70 annotation2494636 1 Phytobrick Adapter Site A range2494636 1 1 4 annotation2494638 1 Phytobrick Adapter Site B range2494638 1 71 74 BBa_K1968008_sequence 1 agtaatggacgtccccttcctggacaccccggggcacgccgcgtttacttcaatgcgtgctcgtagctctctcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z