BBa_K1968010 1 BBa_K1968010 PgdaA constituve promoter from Aspergillus niger 2016-10-11T11:00:00Z 2016-10-12T01:22:44Z The sequence was provided by the Fungal Stock Genetic Center. It was PCR out from plasmid P444 from their collection. Genomic Sequence Glyceraldehyde-3-phosphate dehydrogenase (GPDA) is an enzyme that catalyzes the sixth step of glycolysis. The gene gpdA is constitutively expressed in A. nidulans (Punt et al., 1990). Moreover, the gpdA promoter is able to drive robust transcription of heterologous genes. Intracellularly expressed model heterologous proteins like the E. coli b-galactosidase (lacZ) and b-glucuronidase (uiaA) under the control of the gpdA promoter can account for up to 10???25% of soluble protein in A. niger (Punt, Zegers, Busscher, Pouwels, & van den Hondel, 1991). The ability to drive constitutive tran- scription makes the gpdA promoter particularly useful for expression, under varying cultures conditions, of selection markers and reporter genes, many of which are from heterologous sources. true false _2435_ 30078 30078 9 false Phytobick format and compatible with MoClo (Overhangs E and C) false Alejandra Adriana Schiavon Osorio BBa_K1968010_sequence 1 gatgtctgctcaagcggggtagctgttagtcaagctgcgatgaagtgggaaagctcgaactgaaaggttcaaaggaataagggatgggaaggatggagtatggatgtagcaaagtacttacttaggggaaataaaggttcttggatgggaagatgaatatactgaagatgggaaaagaaagagaaaagaaaagagcagctggtggggagagcaggaaaatatggcaacaaatgttggactgacgcaacgaccttgtcaaccccgccgacacaccgggcggacagacggggcaaagctgcctaccagggactgagggacctcagcaggtcgagtgcagagcaccggatgggtcgactgccagcttgtgttcccggtctgcgccgctggccagctcctgagcggcctttccggtttcatacaccgggcaaagcaggagaggcacgatatttggacgccctacagatgccggatgggccaattagggagcttacgcgccgggtactcgctctacctacttcggagaaggtactatctcgtgaatcttttaccagatcggaagcaattggacttctgtacctaggttaatggcatgctatttcgccgacggctatacacccctggcttcacattctccttcgcttactgccggtgattcgatgaagctccatattctccgaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z