BBa_K1968013 1 BBa_K1968013 PgdaA constituve Phytobrick promoter: Glyceraldehyde-3-phosphate dehydrogenase from Aspergillus nige 2016-10-11T11:00:00Z 2016-10-17T10:56:53Z Genomic Sequence. The sequence was provided by the Fungal Stock Genetic Center. It was PCR out from plasmid P444 from their collection. Glyceraldehyde-3-phosphate dehydrogenase (GPDA) is an enzyme that catalyzes the sixth step of glycolysis. The gene gpdA is constitutively expressed in A. nidulans (Punt et al., 1990). Moreover, the gpdA promoter is able to drive robust transcription of heterologous genes. Intracellularly expressed model heterologous proteins like the E. coli b-galactosidase (lacZ) and b-glucuronidase (uiaA) under the control of the gpdA promoter can account for up to 10???25% of soluble protein in A. niger (Punt, Zegers, Busscher, Pouwels, & van den Hondel, 1991). The ability to drive constitutive tran- scription makes the gpdA promoter particularly useful for expression, under varying cultures conditions, of selection markers and reporter genes, many of which are from heterologous sources. false false _2435_ 9146 30078 9 false Phytrobrick format and MoClo compatible (Overhangs E and C) false Alejandra Adriana Schiavon Osorio annotation2499081 1 Phytobrick Adapter Site E range2499081 1 1 4 annotation2499083 1 PgdaA range2499083 1 5 677 annotation2499082 1 Phytobrick Adapter Site C range2499082 1 678 681 BBa_K1968013_sequence 1 gatgtctgctcaagcggggtagctgttagtcaagctgcgatgaagtgggaaagctcgaactgaaaggttcaaaggaataagggatgggaaggatggagtatggatgtagcaaagtacttacttaggggaaataaaggttcttggatgggaagatgaatatactgaagatgggaaaagaaagagaaaagaaaagagcagctggtggggagagcaggaaaatatggcaacaaatgttggactgacgcaacgaccttgtcaaccccgccgacacaccgggcggacagacggggcaaagctgcctaccagggactgagggacctcagcaggtcgagtgcagagcaccggatgggtcgactgccagcttgtgttcccggtctgcgccgctggccagctcctgagcggcctttccggtttcatacaccgggcaaagcaggagaggcacgatatttggacgccctacagatgccggatgggccaattagggagcttacgcgccgggtactcgctctacctacttcggagaaggtactatctcgtgaatcttttaccagatcggaagcaattggacttctgtacctaggttaatggcatgctatttcgccgacggctatacacccctggcttcacattctccttcgcttactgccggtgattcgatgaagctccatattctccgaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z