BBa_K1968014 1 BBa_K1968014 Tcyc Phytobrick: cytochrome C gene transcriptional terminator from Saccharomyces cerevisiae 2016-10-11T11:00:00Z 2016-10-17T10:57:53Z Genomic Sequence. The sequence was provided by the Fungal Stock Genetic Center. It was PCR out from plasmid P444 from their collection. Tcyc is the genomic terminator in the CYC1 gene. CYC1 encodes the iso-1 form of the electron carrier protein cytochrome c. Iso-1-cytochrome c facilitates the penultimate and last steps of the mitochondrial respiratory chain false false _2435_ 9146 30078 9 false Phytrobrick format and MoClo compatible (Overhangs D and F) false Alejandra Adriana Schiavon Osorio annotation2499300 1 Tcyc range2499300 1 5 231 annotation2499299 1 Phytobrick Adapter Site D range2499299 1 1 4 annotation2499301 1 Phytobrick Adapter Site F range2499301 1 232 235 BBa_K1968014_sequence 1 cgagcgtcccaaaaccttctcaagcaaggttttcagtataatgttacatgcgtacacgcgtttgtacagaaaaaaaagaaaaatttgaaatataaataacgttcttaatactaacataactattaaaaaaaataaatagggacctagacttcaggttgtctaactccttccttttcggttagagcggatgtgggaggagggcgtgaatgtaagcgtgacataactaattacatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z