BBa_K1968021 1 BBa_K1968021 Synechocystis Sca6-2 Promoter with RBS* (LacI repressible) Phytobrick 2016-10-13T11:00:00Z 2016-10-14T07:57:42Z Stevan et al. Promoter Library The Sca6-2 promoter, comes from Albers and co-workers, rational design approach towards the existing tac promoter. Several iterations were generated by mutating nucleotides in a step-wise manner within the −10 and −35 cis-acting regions of the promoter. This produced a library of several promoters with a dynamic range of expression strength as well as its ability to be repressed, thanks to the lac operator sequence located after the -10 region of the promoter. These were further characterized in Synechocystis sp. PCC 6803 by Stevan et al. showing that in the presence of the repressor protein LacI, the promoter was able to remain highly repressed. Subsequently, in the presence of the iPTG inducer, the promoter was able to express high concentrations of protein (Stevan C. Albers et al. 2015). Albers, S.C., Gallegos, V.A. & Peebles, C.A.M., 2015. Engineering of genetic control tools in Synechocystis sp. PCC 6803 using rational design techniques. Journal of Biotechnology, 216, pp.36???46. false false _2435_ 9146 9146 9 false The Phytobrick Standard was used for this part false Ricardo Camilo Ch??vez Mart??nez annotation2505660 1 Phytobrick Adapter Site C range2505660 1 119 122 annotation2505628 1 Phytobrick Adapter Site A range2505628 1 1 4 annotation2505569 1 Promoter Sca6-2 range2505569 1 5 102 annotation2505585 1 RBS* range2505585 1 103 118 BBa_K1968021_sequence 1 ggagaattgtgagcgctcacaattgcatgagagagagctgttgacaattaatcatcgcggctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacagaatcataatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z