BBa_K1968024 1 BBa_K1968024 LacI without LVA-tag (Repressor) Phytobrick 2016-10-13T11:00:00Z 2016-10-17T11:23:29Z Based on the part BBa_K1088018. The LacI protein is required for the adequate repression of Plac derived promoters. Without its binding to the operator region of these promoters, there is nothing blocking transcription and therefore gene expression. In an effort to improve the reaction time of the induction and have better control over induction, research groups have suggested the addition of a LVA degradation tag to the C-terminus of LacI. The LVA tag is a short peptide sequence that marks the intended protein sequence for degradation by cellular proteases (Karzai et al. 2000). In E. coli, however, at least one study seems to show that LacI without the tag actually reacts quicker in response to inducers (Andreassen et al. 2014). In Synechocystis it has been suggested that the amount of LacI present is correlated to the leakiness of LacI dependent promoters (Albers et al. 2015). It has also been reported that the addition of the highly active LVA tag to proteins greatly decreases protein concentration (Wang et al. 2012). It is because of this that the synthesis of a LacI without an LVA tag was decided. Designed under the Phytobrick standard. This part had to be modified from part BBa_K1088018 in order to adjust to the Phytobrick standard. Two BbsI sites had to be removed (Codon in the basepair 494-496 was changed from GAT to GAC, the codon in basepair 962-964 was changed from GTC to GTG maintaining the same aminoacid sequence and making it Phytobrick compatible) Albers, S.C., Gallegos, V.A. & Peebles, C.A.M., 2015. Engineering of genetic control tools in Synechocystis sp. PCC 6803 using rational design techniques. Journal of Biotechnology, 216, pp.36???46. Andreassen, P.R. et al., 2014. Natural LacI from E. coli Yields Faster Response and Higher Level of Expression than the LVA-Tagged LacI. ACS Synthetic Biology, 3(12), pp.949???952. Wang, B. et al., 2012. Application of synthetic biology in cyanobacteria and algae. Frontiers in Microbiology, 3, p.344. false false _2435_ 9146 9146 9 false Designed under the Phytobrick standard. This part had to be modified in order to adjust to the Phytobrick standard. Two BbsI sites had to be removed (Codon in the basepair 494-496 was changed from GAT to GAC, the codon in basepair 962-964 was changed from GTC to GTG maintaining the same aminoacid sequence and making it Phytobrick compatible) false Ricardo Camilo Ch??vez Mart??nez annotation2506119 1 LacI range2506119 1 2 1084 annotation2506120 1 Phytobrick Adapter Site D range2506120 1 1085 1088 annotation2506118 1 Phytobrick Adapter Site C range2506118 1 1 4 BBa_K1968024_sequence 1 aatgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagatggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagatagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtgtcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgaaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z