BBa_K1969005 1 BBa_K1969005 CUP1 promoter 2016-10-07T11:00:00Z 2016-10-08T09:05:47Z The genomic sequence from Saccharomyces cerevisiae. This is the full length of CUP1 promoter in yeast Saccharomyces cerevisiae. As the major copper-activated metallothionine in yeast, Cup1p binds and sequesters cuprous copper(I), Cu+, providing the principal method of removing this metal ion from the cell. CUP1 transcription is specifically induced by the copper-dependent transcription activator Cup2p (more commonly known as Ace1p) in response to high levels of copper ions and by Hsf1p in response to heat shock, glucose starvation and oxidation stress. In the presence of copper, Cup1p is also capable of antioxidant activity and thus contributes a significant, albeit minor, role to oxygen radical detoxification, especially in the absence of Cu,Zn-superoxide dismutase Sod1p. false false _2436_ 29963 29963 9 false As the promoter sequence is rather short, we may use recombinase to inset it upstream different coding sequence to control the expression level. false Yijie Lai annotation2487976 1 CUP1 promoter range2487976 1 1 235 BBa_K1969005_sequence 1 ctagttagaaaaagacatttttgctgtcagtcactgtcaagagattcttttgctggcatttcttctagaagcaaaaagagcgatgcgtcttttccgctgaaccgttccagcaaaaaagactaccaacgcaatatggattgtcagaatcatataaaagagaagcaaataactccttgtcttgtatcaattgcattataatatcttcttgttagtgcaatatcatatagaagtcatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z