BBa_K1969009 1 BBa_K1969009 The linker sequence between ADH1 terminator and different coding sequences 2016-10-08T11:00:00Z 2016-10-12T06:28:04Z It's artificially designed . This is the linker sequence between ADH1 terminator and Nano-lantern(cAMP-1.6) to introduce the AvrII and AscI unique cut sites. false false _2436_ 29963 29963 9 false We need AvrII and AscI unique cut sites to assemble the parts together. false Yijie Lai annotation2489076 1 Linker between ADH1 terminator and Nano-lantern(cAMP-1.6) range2489076 1 1 29 BBa_K1969009_sequence 1 cctaggtgaggcgcgccacttctaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z