BBa_K1969011 1 BBa_K1969011 Linker sequence between ADH1 terminator and two coding sequences downstream GAL1 promoter 2016-10-09T11:00:00Z 2016-10-12T06:33:57Z It is designed artificially. This is the linker sequence between ADH1 terminator and Nano-lantern(cAMP-1.6) (downstream GAL1 promoter). false false _2436_ 29963 29963 9 false It is designed for homologous recombination with the backbone plasmid used to insert in the HIS3 site in yeast. false Yijie Lai annotation2495427 1 Linker sequence between ADH1 terminator and Nano-lantern(cAMP-1.6) (downstream GAL1 promoter) range2495427 1 1 20 BBa_K1969011_sequence 1 ggcgcgccacttctaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z