BBa_K1969012 1 BBa_K1969012 Linker sequence between CUP1 promoter and Nano-lantern(cAMP-1.6) 2016-10-09T11:00:00Z 2016-10-12T06:40:08Z It's designed artificially. This is the linker sequence between CUP1 promoter and Nano-lantern(cAMP-1.6) to introduce ClaI, MseI sites. false false _2436_ 29963 29963 9 false It is used to introduce ClaI, MseI sites and left by homologous recombination. false Yijie Lai annotation2489595 1 Linker sequence between CUP1 promoter and Nano-lantern(cAMP-1.6) range2489595 1 1 68 BBa_K1969012_sequence 1 gaaatagatattaagaaaaacaaactgtacaatcaatcaatcaatcatcacataaaatgtctatcgat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z