BBa_K1969015 1 BBa_K1969015 The linker sequence between ADH1 promoter and ADRB2 2016-10-11T11:00:00Z 2016-10-12T06:52:10Z It is designed artificially. This DNA sequence is used to link the ADH1 promoter and ADRB2 together and introduce the restriction site for ClaI. false false _2436_ 29963 29963 9 false As we didn't have the enzyme required for biobrick assembly, we introduced the restriction site for ClaI. false Yijie Lai annotation2493924 1 Linker sequence between ADH1 promoter and ADRB2 range2493924 1 1 31 BBa_K1969015_sequence 1 atctcatatacaatgtctatcccaatcgata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z