BBa_K1969016 1 BBa_K1969016 The linker sequence between ADH1 promoter and ADRB2 (with His-tag) 2016-10-11T11:00:00Z 2016-10-12T09:31:24Z It is designed artificially. This DNA sequence is used to link the ADH1 terminator and ADRB2 together and introduce the restriction sites for AvrII and AscI. false false _2436_ 29963 29963 9 false We wanted to introduce the restriction sites for AvrII and AscI to make it suitable for other elements. false Yijie Lai annotation2493967 1 Linker sequence between ADH1 promoter and ADRB2 (with His-tag) range2493967 1 1 39 BBa_K1969016_sequence 1 atctcatatacaatgtctatcccaatcgatattaattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z