BBa_K1969017 1 BBa_K1969017 The linker sequence between GAL1 promoter and ADRB2 2016-10-11T11:00:00Z 2016-10-12T09:43:26Z It is designed artificially. This DNA sequence is used to link the ADH1 terminator and ADRB2 (with His-tag) together and introduce the restriction sites for AscI and AvrII. false false _2436_ 29963 29963 9 false Introduction of the restriction sites for AscI and AvrII may make the construct more suitable for other elements. false Yijie Lai annotation2493982 1 Linker sequence between GAL1 promoter and ADRB2 range2493982 1 1 49 BBa_K1969017_sequence 1 atgtcgtacgctgcaggtcgtgggattcctgggttaattaaatcgatgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z