BBa_K1969018 1 BBa_K1969018 The linker sequence between GAL1 promoter and ADRB2 (with His-tag) 2016-10-11T11:00:00Z 2016-10-12T09:51:54Z It is designed artificially. This DNA sequence is used to link the GAL1 promoter and ADRB2 (with His-tag) together and introduce the restriction site for PacI. false false _2436_ 29963 29963 9 false Introduction of the restriction sites for PacI may make the construct more suitable for other elements. false Yijie Lai annotation2494019 1 Linker sequence between GAL1 promoter and ADRB2 (with His-tag) range2494019 1 1 41 BBa_K1969018_sequence 1 atgtcgtacgctgcaggtcgtgggattcctgggttaattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z